ID: 1203260060_1203260077

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1203260060 1203260077
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270733v1_random:168251-168273 22_KI270733v1_random:168298-168320
Sequence CCCTCCTCCGGTCGCCGCCGCGG GCTCGTCGGTGTGGGGTTCGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!