ID: 1203289118_1203289125

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1203289118 1203289125
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270735v1_random:17258-17280 22_KI270735v1_random:17290-17312
Sequence CCCATCGCCGCCACGTGCAAGGC CAAGACTCAGCGGCCCAGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 31, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!