ID: 1203456765_1203456772

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1203456765 1203456772
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000219v1:175558-175580 Un_GL000219v1:175574-175596
Sequence CCCCATGGGATAGTCTGAAATAT GAAATATGGCCTTATGGGAAGGG
Strand - +
Off-target summary {0: 6, 1: 529, 2: 187, 3: 149, 4: 211} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!