ID: 1203471385_1203471397 |
View in Genome Browser |
Spacer: -4 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1203471385 | 1203471397 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | Un_GL000220v1:116680-116702 | Un_GL000220v1:116699-116721 |
| Sequence | CCCCCCCCCCACCCCACGTCTCG | CTCGTCGCGCGCGCGTCCGCTGG |
| Strand | - | + |
| Off-target summary | {0: 5, 1: 2, 2: 9, 3: 135, 4: 1738} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||