ID: 1203471385_1203471404

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1203471385 1203471404
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000220v1:116680-116702 Un_GL000220v1:116712-116734
Sequence CCCCCCCCCCACCCCACGTCTCG CGTCCGCTGGGGGCGGGGAGCGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 9, 3: 135, 4: 1738} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!