ID: 1203471394_1203471406 |
View in Genome Browser |
Spacer: 2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1203471394 | 1203471406 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | Un_GL000220v1:116691-116713 | Un_GL000220v1:116716-116738 |
| Sequence | CCCCACGTCTCGTCGCGCGCGCG | CGCTGGGGGCGGGGAGCGGTCGG |
| Strand | - | + |
| Off-target summary | No data | {0: 7, 1: 0, 2: 6, 3: 79, 4: 722} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||