ID: 1203471396_1203471408

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1203471396 1203471408
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000220v1:116693-116715 Un_GL000220v1:116720-116742
Sequence CCACGTCTCGTCGCGCGCGCGTC GGGGGCGGGGAGCGGTCGGGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!