ID: 1203476116_1203476136

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1203476116 1203476136
Species Human (GRCh38) Human (GRCh38)
Location Un_GL000220v1:149924-149946 Un_GL000220v1:149967-149989
Sequence CCCCGCGGGGGTCCCCTCGTCTC GGTGCGTGTGGGAAGGCGTGGGG
Strand - +
Off-target summary No data {0: 8, 1: 0, 2: 0, 3: 22, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!