ID: 1203546787_1203546790

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1203546787 1203546790
Species Human (GRCh38) Human (GRCh38)
Location Un_KI270743v1:134163-134185 Un_KI270743v1:134176-134198
Sequence CCAAGCTGTACCTGTGCATCTTT GTGCATCTTTCAGCCATGGCTGG
Strand - +
Off-target summary No data {0: 42, 1: 49, 2: 25, 3: 80, 4: 677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!