ID: 1203563220_1203563228

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1203563220 1203563228
Species Human (GRCh38) Human (GRCh38)
Location Un_KI270744v1:74509-74531 Un_KI270744v1:74528-74550
Sequence CCAGCCTCTGCCAGGCAGCATGG ATGGCCCTGGGTGGCTTTCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!