ID: 355997724_355997725

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 355997724 355997725
Species Mouse (GRCm38) Mouse (GRCm38)
Location 12:99965982-99966004 12:99965998-99966020
Sequence CCTGAACGAGGACAACGCGCGCT GCGCGCTTCCTGCTGCTCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 9} {0: 1, 1: 0, 2: 0, 3: 8, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!