|
Left Crispr |
Right Crispr |
| Crispr ID |
377510963 |
377510968 |
| Species |
Mouse (GRCm38) |
Mouse (GRCm38) |
| Location |
14:68087374-68087396
|
14:68087408-68087430
|
| Sequence |
CCAAAGAATCTGAAGAGGAAGAG |
GAGTGCTGGAGAGGAGCAGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 1, 3: 39, 4: 352} |
{0: 1, 1: 0, 2: 3, 3: 58, 4: 785} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|