ID: 377510981_377510985

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 377510981 377510985
Species Mouse (GRCm38) Mouse (GRCm38)
Location 14:68087507-68087529 14:68087555-68087577
Sequence CCAACCAGTTGAGTTCCAGATCC GTATAATTCTGAGATGACTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133} {0: 1, 1: 0, 2: 1, 3: 14, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!