ID: 485343919_485343920

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 485343919 485343920
Species Mouse (GRCm38) Mouse (GRCm38)
Location 5:66975313-66975335 5:66975350-66975372
Sequence CCTTTACAGTAGAAAAGCGTTTT AAGTTTGCAAGAGCCCAGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 132} {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
14 5:66975313-66975335 CCTTTACAGTAGAAAAGCGTTTT - 5:66975350-66975372 AAGTTTGCAAGAGCCCAGTATGG +