ID: 485343919_485343921

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 485343919 485343921
Species Mouse (GRCm38) Mouse (GRCm38)
Location 5:66975313-66975335 5:66975353-66975375
Sequence CCTTTACAGTAGAAAAGCGTTTT TTTGCAAGAGCCCAGTATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 132} {0: 1, 1: 0, 2: 2, 3: 7, 4: 158}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
17 5:66975313-66975335 CCTTTACAGTAGAAAAGCGTTTT - 5:66975353-66975375 TTTGCAAGAGCCCAGTATGGAGG +