ID: 485345259_485345264

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 485345259 485345264
Species Mouse (GRCm38) Mouse (GRCm38)
Location 5:66988294-66988316 5:66988320-66988342
Sequence CCGTTTTCAAGTACCAGCTGCGT AGGGGCCTCGCTAAATTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74} {0: 1, 1: 0, 2: 0, 3: 7, 4: 32}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
3 5:66988294-66988316 CCGTTTTCAAGTACCAGCTGCGT - 5:66988320-66988342 AGGGGCCTCGCTAAATTAAAAGG +