ID: 485345263_485345265

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 485345263 485345265
Species Mouse (GRCm38) Mouse (GRCm38)
Location 5:66988307-66988329 5:66988321-66988343
Sequence CCAGCTGCGTGACAGGGGCCTCG GGGGCCTCGCTAAATTAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 58} {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
-9 5:66988307-66988329 CCAGCTGCGTGACAGGGGCCTCG - 5:66988321-66988343 GGGGCCTCGCTAAATTAAAAGGG +