ID: 551982222_551982233

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 551982222 551982233
Species Mouse (GRCm38) Mouse (GRCm38)
Location 9:119542944-119542966 9:119542997-119543019
Sequence CCAGGGAGATTCTTTCACTGCCT GGCATATCGAAAGGGCCTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!