ID: 551982227_551982233

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 551982227 551982233
Species Mouse (GRCm38) Mouse (GRCm38)
Location 9:119542967-119542989 9:119542997-119543019
Sequence CCCGGCTCTGGCAAAGGTATTCT GGCATATCGAAAGGGCCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 155} {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
7 9:119542967-119542989 CCCGGCTCTGGCAAAGGTATTCT - 9:119542997-119543019 GGCATATCGAAAGGGCCTTCTGG +