ID: 900119928_900119940

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 900119928 900119940
Species Human (GRCh38) Human (GRCh38)
Location 1:1044254-1044276 1:1044273-1044295
Sequence CCCGGTGAGCTCTGTACCCCTGG CTGGCTCTCGGCGGGCGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 207} {0: 1, 1: 0, 2: 0, 3: 16, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!