ID: 900167566_900167580

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 900167566 900167580
Species Human (GRCh38) Human (GRCh38)
Location 1:1249589-1249611 1:1249622-1249644
Sequence CCGCCCTACAGGCCGGGACACGG GAGGCTAGACCGAGGGAGGCTGG
Strand - +
Off-target summary {0: 12, 1: 1, 2: 0, 3: 6, 4: 98} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!