ID: 900223175_900223185

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 900223175 900223185
Species Human (GRCh38) Human (GRCh38)
Location 1:1520262-1520284 1:1520310-1520332
Sequence CCTGAAGGCGGCCGAGCACCGTC AGCACTGCCGAGGCCCGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 37} {0: 1, 1: 2, 2: 2, 3: 14, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!