ID: 900254564_900254566

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 900254564 900254566
Species Human (GRCh38) Human (GRCh38)
Location 1:1691316-1691338 1:1691343-1691365
Sequence CCTTTCTGAACCTCATCTCAGAA CATCCTTCCCTTCTGCTGTCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 23, 4: 292} {0: 2, 1: 1, 2: 3, 3: 46, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!