ID: 900255050_900255060

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 900255050 900255060
Species Human (GRCh38) Human (GRCh38)
Location 1:1693500-1693522 1:1693532-1693554
Sequence CCGGGGCGGGGCCTTCGTATCCA CGGGGCTGCCGCGGGACATCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 3, 4: 56} {0: 2, 1: 0, 2: 0, 3: 7, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!