ID: 900256972_900256979

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 900256972 900256979
Species Human (GRCh38) Human (GRCh38)
Location 1:1702424-1702446 1:1702447-1702469
Sequence CCTTGTATAAAAACCTGTCGAGT CTGCTGGCACAGCTGGGGCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 72} {0: 2, 1: 2, 2: 6, 3: 56, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!