ID: 900287691_900287706

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 900287691 900287706
Species Human (GRCh38) Human (GRCh38)
Location 1:1909305-1909327 1:1909340-1909362
Sequence CCGGGCTCCCCCGCCTTTCCCCG CGCACGGCGGTGGCGAGCACCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!