ID: 900379524_900379532

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 900379524 900379532
Species Human (GRCh38) Human (GRCh38)
Location 1:2377017-2377039 1:2377042-2377064
Sequence CCAGGCACAGTCCAGGCCGATGC AGCGTGGAGAGTTACGTGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 146} {0: 1, 1: 0, 2: 0, 3: 4, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!