|
Left Crispr |
Right Crispr |
| Crispr ID |
900434958 |
900434961 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:2625576-2625598
|
1:2625612-2625634
|
| Sequence |
CCTGCTATCTTCTGCAGTTAACT |
GACAGCTCTTGGCCCGTTACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 10, 2: 206, 3: 206, 4: 239} |
{0: 5, 1: 170, 2: 191, 3: 131, 4: 143} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|