ID: 900467015_900467035

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 900467015 900467035
Species Human (GRCh38) Human (GRCh38)
Location 1:2830850-2830872 1:2830891-2830913
Sequence CCCTGCCCCGCCCCCGCCCCCGC CTCCCGGAGCCCCGGCGAGGGGG
Strand - +
Off-target summary {0: 2, 1: 23, 2: 247, 3: 947, 4: 5070} {0: 1, 1: 0, 2: 1, 3: 27, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!