|
Left Crispr |
Right Crispr |
| Crispr ID |
900467015 |
900467038 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:2830850-2830872
|
1:2830895-2830917
|
| Sequence |
CCCTGCCCCGCCCCCGCCCCCGC |
CGGAGCCCCGGCGAGGGGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 23, 2: 247, 3: 947, 4: 5070} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|