ID: 900649232_900649238

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 900649232 900649238
Species Human (GRCh38) Human (GRCh38)
Location 1:3722893-3722915 1:3722918-3722940
Sequence CCTCTGCACCTAGCACAGGAGTG CACCTCTCTGCACCTGGCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 498} {0: 2, 1: 4, 2: 5, 3: 29, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!