ID: 900791790_900791798

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 900791790 900791798
Species Human (GRCh38) Human (GRCh38)
Location 1:4685655-4685677 1:4685692-4685714
Sequence CCTGCCCCAGCGAAGGAGAGGCA GGCTCCTTGGCGCCATGTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 243} {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!