ID: 900791792_900791802

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 900791792 900791802
Species Human (GRCh38) Human (GRCh38)
Location 1:4685660-4685682 1:4685704-4685726
Sequence CCCAGCGAAGGAGAGGCAAGCTC CCATGTTAGGGTGCACCGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137} {0: 1, 1: 0, 2: 0, 3: 11, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!