ID: 901361362_901361370

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 901361362 901361370
Species Human (GRCh38) Human (GRCh38)
Location 1:8703414-8703436 1:8703443-8703465
Sequence CCGGGAGAGAAAGAGCAGACTCC CGGCGGCGGCCGGCAAAACCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 250} {0: 1, 1: 0, 2: 1, 3: 7, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!