ID: 901383910_901383915

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 901383910 901383915
Species Human (GRCh38) Human (GRCh38)
Location 1:8894036-8894058 1:8894059-8894081
Sequence CCCAGGAGGAGGGATTCCCTGAC TTTGACACACATGGCCACCTTGG
Strand - +
Off-target summary {0: 18, 1: 18, 2: 7, 3: 86, 4: 865} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!