ID: 901441951_901441960

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 901441951 901441960
Species Human (GRCh38) Human (GRCh38)
Location 1:9283369-9283391 1:9283400-9283422
Sequence CCCAGATCCCCACTTGGGCCTGT CAAGTTGGTGGACAGTGGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 181} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!