ID: 901441954_901441962

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 901441954 901441962
Species Human (GRCh38) Human (GRCh38)
Location 1:9283377-9283399 1:9283405-9283427
Sequence CCCACTTGGGCCTGTCTGAAAAG TGGTGGACAGTGGCTAGGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 47, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!