ID: 901444627_901444630

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 901444627 901444630
Species Human (GRCh38) Human (GRCh38)
Location 1:9300533-9300555 1:9300560-9300582
Sequence CCACAAATAACTTCATTCCTTTT GACAGCTCTTGGCCTAATACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 63, 4: 612} {0: 1, 1: 17, 2: 196, 3: 211, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!