ID: 901646280_901646292

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 901646280 901646292
Species Human (GRCh38) Human (GRCh38)
Location 1:10718478-10718500 1:10718520-10718542
Sequence CCAGTCTGTCCACCTGCTCCCCA CTTCTCCAAGAACCCCAAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 587} {0: 1, 1: 0, 2: 2, 3: 21, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!