ID: 901646288_901646292

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 901646288 901646292
Species Human (GRCh38) Human (GRCh38)
Location 1:10718497-10718519 1:10718520-10718542
Sequence CCCAAGGAGGGCACGCCAGGCTC CTTCTCCAAGAACCCCAAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 129} {0: 1, 1: 0, 2: 2, 3: 21, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!