ID: 901904050_901904052

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 901904050 901904052
Species Human (GRCh38) Human (GRCh38)
Location 1:12392659-12392681 1:12392686-12392708
Sequence CCAAGAGCTGTCTCTCAAAAGGA AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 181, 1: 197, 2: 163, 3: 130, 4: 293} {0: 185, 1: 187, 2: 104, 3: 111, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!