ID: 901975701_901975714

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 901975701 901975714
Species Human (GRCh38) Human (GRCh38)
Location 1:12942267-12942289 1:12942318-12942340
Sequence CCCATCGAGCACAGCTTGGAAGG CCTCAGAGGGAGGCGGCGGAAGG
Strand - +
Off-target summary {0: 8, 1: 2, 2: 0, 3: 6, 4: 63} {0: 9, 1: 0, 2: 0, 3: 31, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!