ID: 902153398_902153405

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 902153398 902153405
Species Human (GRCh38) Human (GRCh38)
Location 1:14463079-14463101 1:14463110-14463132
Sequence CCACTTTTAATTACATGCAAATT GGTTAATGCAAATTGAGGAATGG
Strand - +
Off-target summary {0: 61, 1: 176, 2: 260, 3: 217, 4: 542} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!