ID: 902153398_902153406

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 902153398 902153406
Species Human (GRCh38) Human (GRCh38)
Location 1:14463079-14463101 1:14463130-14463152
Sequence CCACTTTTAATTACATGCAAATT TGGATTATTTAGAACTTTCTAGG
Strand - +
Off-target summary {0: 61, 1: 176, 2: 260, 3: 217, 4: 542} {0: 1, 1: 15, 2: 31, 3: 73, 4: 447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!