ID: 902155467_902155473

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 902155467 902155473
Species Human (GRCh38) Human (GRCh38)
Location 1:14482063-14482085 1:14482113-14482135
Sequence CCAGGCAATGTCGGACAGCTTGA TAGATGGCCAAAGGCCAGATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!