ID: 902711743_902711747

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 902711743 902711747
Species Human (GRCh38) Human (GRCh38)
Location 1:18244630-18244652 1:18244660-18244682
Sequence CCTCTGTGTCTCAGGCCTGGTGC TGCCACAGAGGCCCCTGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 382} {0: 1, 1: 0, 2: 2, 3: 47, 4: 462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!