ID: 902794477_902794479

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 902794477 902794479
Species Human (GRCh38) Human (GRCh38)
Location 1:18792253-18792275 1:18792285-18792307
Sequence CCTTGATCTTGTTCTTGAACGAT CTGAATATACAAATGGACAATGG
Strand - +
Off-target summary No data {0: 13, 1: 48, 2: 64, 3: 98, 4: 529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!