ID: 902974474_902974480

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 902974474 902974480
Species Human (GRCh38) Human (GRCh38)
Location 1:20078981-20079003 1:20079000-20079022
Sequence CCCACTGTAGTCTCAGCTACTCG CTCGAGAGGCAGAGGCAGGAGGG
Strand - +
Off-target summary {0: 2, 1: 36, 2: 574, 3: 1809, 4: 2757} {0: 1, 1: 15, 2: 157, 3: 1002, 4: 2899}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!