ID: 903156234_903156239

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 903156234 903156239
Species Human (GRCh38) Human (GRCh38)
Location 1:21445620-21445642 1:21445635-21445657
Sequence CCTGCATCCCCCAGGCTAAGGCT CTAAGGCTCCTACACTGTCCTGG
Strand - +
Off-target summary {0: 4, 1: 5, 2: 3, 3: 23, 4: 240} {0: 2, 1: 0, 2: 1, 3: 11, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!