ID: 903241789_903241793

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 903241789 903241793
Species Human (GRCh38) Human (GRCh38)
Location 1:21987564-21987586 1:21987582-21987604
Sequence CCATAGTGCGCTATACCCATCTG ATCTGGTTCTGCACCAAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 39} {0: 1, 1: 1, 2: 1, 3: 5, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!